ࡱ> <>;Q  bjbj55 .2WeWe5^TT8,t-:g(jjj${1!djjjjjjj]`Fr0!!!jjjjjjj4jjjjjjj!jjjjjjjjjT _:  Introducing yeast mutations with Cas9 This is written for introduction of an individual point mutation in the yeast genome. Principle Cas9 cleaves nearby your chosen mutation site, forming a double strand break that is repaired using an oligonucleotide repair template containing your mutation. You need to clone your Cas9 guide sequence into a Cas9 expression plasmid, then transform this plasmid along with the repair template oligo into your target strain. You will need 6 oligos: 2 oligos for cloning the guide RNA 2 repair template oligos 2 testing oligos lying 100-400 nt each side of the mutation site so you can amplify and sequence to confirm the mutation. Design of the guide RNA oligos Guides contain about 20 nt of specific sequence adjacent to a PAM sequence, the PAM is critical for cleavage but it is not part of the guide. Cas9 cleaves 3-4 nt away from the PAM in the guide sequence. Optimal guide sites are not trivial to select. Helpfully, the Wyrick lab have an online tool to pick out good guide sites in any region of the yeast genome.  HYPERLINK "http://wyrickbioinfo2.vetmed.wsu.edu/" http://wyrickbioinfo2.vetmed.wsu.edu/ You need to select a guide that cleaves as close as possible to the mutation that you wish to introduce. Remember that Cas9 will cleave next to the PAM sequence. The guide sequence must be cloned into an expression vector that also expresses Cas9, we use pML104 from the Wyrick lab. The guide sequence is made by annealing 2 oligos designed by the tool above and cloning into pML104 digested with BclI and SwaI. Check whether the oligo sequences that are designed by the website contain a ClaI site (ATCGAT) - look at the longer of the two. If it does, check whether it overlaps a GATC sequence. If the guide oligo contains a ClaI site that does not overlap a GATC then you cannot validate cloned guides by restriction digestion and will need to check them by sequencing. Not a huge problem, just be aware. Design of the repair template oligos You need two oligos that anneal together to form a dsDNA template. I have not been able to find clear design rules for the repair template oligos but it would seem sensible if the mutations to PAM and desired mutation are roughly in the middle and the total length is 90-100 nt. The repair template oligo should contain the mutation of choice, and it must also contain a mutation that disrupts the 3nt PAM sequence. Mutating the PAM site is critical - if you dont mutate it then Cas9 will just keep cleaving the same site even after your mutation is introduced, which will prevent the cell proliferating. As the PAM site is normally within the protein coding sequence of the gene you are mutating, make sure that the mutation you use to destroy the PAM sequence is silent. The PAM is NGG, and NAG is also cut with reduced efficiency so you need to change the PAM so that it is no longer NGG or NAG. To make life easy when screening for mutations, it is strongly advised to put in an additional silent mutation the as close as possible to your desired mutation but on the other side from the PAM site that creates or deletes a restriction enzyme site. Ideally this site should be for an enzyme we already have, and should be one that works well in a PCR mix: I have used this tool to find mutations that introduce restriction sites:  HYPERLINK "https://molbiotools.com/silentmutator.php" https://molbiotools.com/silentmutator.php This table gives the activity of enzymes in OneTaq buffer  HYPERLINK "https://uk.neb.com/tools-and-resources/usage-guidelines/activity-of-restriction-enzymes-in-pcr-buffers" https://uk.neb.com/tools-and-resources/usage-guidelines/activity-of-restriction-enzymes-in-pcr-buffers And here is a table of the restriction enzymes we have "N:\Ordering\JH lab restriction enzymes.docx" Protocol Design and order your oligos. Get some digested pML104. If nobody has any, make it as follows: Mini prep pML104 grown in dam- e. Coli. We have a glycerol stock of this already. This is required as BclI is methylation sensitive. Digest 1ug of plasmid over night at 25 with 1ul SwaI in 50 ul total volume of NEBuffer 3.1. Do this in a PCR machine with the heated lid off Add 1ul BclI (note do not use the HF version as the buffer required isnt compatible with SwaI), mix by pipetting and put back in the PCR machine at 50 with the lid at 60 - incubate for 2 hours Gel extract the product, elute DNA in 50ul Once you have digested plasmid: Anneal your guide oligos - mix 10ul each guide oligo (100uM), 10ul NEBuffer 2 or 2.1, 70ul water, heat to 90 then allow to cool on the bench. Make a 1:100 dilution. Also anneal your repair template oligos in the same way. Mix 1ul digested pML104, 1ul 1:100 annealed oligos 6ul water Heat to 50 then cool to room temperature Add 1ul T4 DNA ligase buffer 1ul T4 DNA ligase Ligate at room temperature for an hour Transform and plate on ampicillin - Alex got this to work with the normal competence DH5alpha's, I had to use the high competence NEB ones. Miniprep 4 colonies and perform a test digestion with ClaI (unless your guide oligos contain a ClaI site). Putative positive colonies will give a single band >10kb, reformed parental plasmid will give two overlapping bands at 5.3 and 5.9kb Verify 2 putative positive clones by sequencing from M13 rev (AGCGGATAACAATTTCACACAGG) - we have this oligo, JH1847 Transform 2ul pML104-guide plasmid and 10ul of the annealed 10uM repair template into your target strain. This needs to have a URA3 auxotrophy Plate the cells on a -URA plate Restreak 6 colonies Amplify a 12.5ul OneTaq PCR product (see PCR protocol) using the testing oligos from all 6 clones, and also from the parental strain, add 0.25ul of the informative restriction enzyme and digest for 1h at 37, then run on a gel. If you used an enzyme that doesnt work in PCR mix then purify using 0.9x AMPure beads first. Efficiency can be very variable, you may need to screen more colonies. Amplify the same 50ul OneTaq product from 1-3 positive colonies, check 5ul on a gel, if it is good, PCR purify, quantify and sequence from one of the primers used for amplification      FILENAME Yeast point mutation using Cas9.doc v1.1 Houseley lab  PAGE 1 &'(  $ % ( 0 * + 7 \ ^ _   ( ) (`þضز؞؞Þ؞#jhCJOJQJU^JaJ hhhh}Ch0J hhhjhU hQ6 h6hQh2{hHh+ 6h+ hMh)5hM5CJ(aJ(h+ h+ 5CJ(aJ( h+ h+ 3'() & ) * * + &'gd+ gd)`gd+ `aw abvw9^gdgdgd+ KLuvw$&',>Efno%,-7DJKU^js 8=BK& 4 ̽Ĵ̨̰̰̰̽̚hQOJQJ^JhQhOJQJ^JhHh+ 6h+ h_Qh0J hhjhUhh0JCJOJQJ^JaJ#jhCJOJQJU^JaJhCJOJQJ^JaJ69:ef,-fg./!"`gdHgd+ ^gdqr' ( ) * , 1 2 3 4 5 7 8 : ; = > @ A gd+ 4 5 6 8 9 ; < > ? A B L M p q u v  Ƶh0JmHnHu h(0Jjh(0JUh%h2{h2{mHnHuh(jh(UhhjhhU h)h) ,1h. A!"#$% w2 0@P`p2( 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p8XV~ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@ 0@6666_HmH nH sH tH @`@ NormalCJ_HaJmH sH tH DA`D Default Paragraph FontRiR  Table Normal4 l4a (k (No List 4@4 Mr2Header  9r 4 @4 Mr2Footer  9r .)@. Mr2 Page Number6U`!6 H Hyperlink >*B*phcRv!1R H0Unresolved MentionB*ph`^\q PK![Content_Types].xmlN0EH-J@%ǎǢ|ș$زULTB l,3;rØJB+$G]7O٭VGRU1a$N% ʣꂣKЛjVkUDRKQj/dR*SxMPsʧJ5$4vq^WCʽ D{>̳`3REB=꽻Ut Qy@֐\.X7<:+& 0h @>nƭBVqu ѡ{5kP?O&Cנ Aw0kPo۵(h[5($=CVs]mY2zw`nKDC]j%KXK 'P@$I=Y%C%gx'$!V(ekڤք'Qt!x7xbJ7 o߼W_y|nʒ;Fido/_1z/L?>o_;9:33`=—S,FĔ觑@)R8elmEv|!ո/,Ә%qh|'1:`ij.̳u'k CZ^WcK0'E8S߱sˮdΙ`K}A"NșM1I/AeހQתGF@A~eh-QR9C 5 ~d"9 0exp<^!͸~J7䒜t L䈝c\)Ic8E&]Sf~@Aw?'r3Ȱ&2@7k}̬naWJ}N1XGVh`L%Z`=`VKb*X=z%"sI<&n| .qc:?7/N<Z*`]u-]e|aѸ¾|mH{m3CԚ .ÕnAr)[;-ݑ$$`:Ʊ>NVl%kv:Ns _OuCX=mO4m's߸d|0n;pt2e}:zOrgI( 'B='8\L`"Ǚ 4F+8JI$rՑVLvVxNN";fVYx-,JfV<+k>hP!aLfh:HHX WQXt,:JU{,Z BpB)sֻڙӇiE4(=U\.O. +x"aMB[F7x"ytѫиK-zz>F>75eo5C9Z%c7ܼ%6M2ˊ 9B" N "1(IzZ~>Yr]H+9pd\4n(Kg\V$=]B,lוDA=eX)Ly5ot e㈮bW3gp : j$/g*QjZTa!e9#i5*j5ö fE`514g{7vnO(^ ,j~V9;kvv"adV݊oTAn7jah+y^@ARhW.GMuO "/e5[s󿬅`Z'WfPt~f}kA'0z|>ܙ|Uw{@՘tAm'`4T֠2j ۣhvWwA9 ZNU+Awvhv36V`^PK! ѐ'theme/theme/_rels/themeManager.xml.relsM 0wooӺ&݈Э5 6?$Q ,.aic21h:qm@RN;d`o7gK(M&$R(.1r'JЊT8V"AȻHu}|$b{P8g/]QAsم(#L[PK-![Content_Types].xmlPK-!֧6 0_rels/.relsPK-!kytheme/theme/themeManager.xmlPK-!g theme/theme/theme1.xmlPK-! ѐ' theme/theme/_rels/themeManager.xml.relsPK] 2 PP]]]`4 9 *^ K u &XX4X ;QXZ`!8@0(  B S  ?f $#T W T c d u or|,/06IM^brx578:;=>@Arv578:;=>@A* 28*45588A* 28*45Aquv)(xQMmp.%*`/Mr2; BcH7TYs,[QycRdgxomu2{./|fL0h(sFu7 + bRn()SHd57@@UnknownG.[x Times New Roman5Symbol3. .[x Arial7..{$ CalibriC.,.{$ Calibri LightA$BCambria Math"qh( + +!r4))3qHP ?72!xxH "  Prepare 0jhousele Jon Houseley Oh+'0  < H T`hpx Prepare 0 jhousele Normal.dotmJon Houseley6Microsoft Office Word@~@C@ ՜.+,D՜.+,H hp  University of Edinburgh+ )  Prepare 0 TitleX 8@ _PID_HLINKSA7ghttps://uk.neb.com/tools-and-resources/usage-guidelines/activity-of-restriction-enzymes-in-pcr-buffersP[*https://molbiotools.com/silentmutator.phpV&http://wyrickbioinfo2.vetmed.wsu.edu/  !"#$%&'()*,-./012456789:=Root Entry F??1Table!WordDocument.2SummaryInformation(+DocumentSummaryInformation83CompObjr  F Microsoft Word 97-2003 Document MSWordDocWord.Document.89q